home / skills / gptomics / bioskills / codon-usage
This skill analyzes codon usage, computes CAI, and examines synonymous bias using Biopython to aid expression optimization and evolutionary analysis.
npx playbooks add skill gptomics/bioskills --skill codon-usageReview the files below or copy the command above to add this skill to your agents.
---
name: bio-codon-usage
description: Analyze codon usage, calculate CAI (Codon Adaptation Index), and examine synonymous codon bias using Biopython. Use when analyzing coding sequences for expression optimization or evolutionary analysis.
tool_type: python
primary_tool: Bio.SeqUtils.CodonUsage
---
## Version Compatibility
Reference examples tested with: BioPython 1.83+
Before using code patterns, verify installed versions match. If versions differ:
- Python: `pip show <package>` then `help(module.function)` to check signatures
If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.
# Codon Usage
Analyze codon usage patterns and calculate codon adaptation metrics using Biopython.
**"Analyze codon usage"** → Count codons in a coding sequence, compute frequencies and bias metrics.
- Python: `Counter` on 3-mers + `CodonAdaptationIndex` (BioPython)
**"Optimize codons for expression"** → Replace codons with host-preferred synonymous codons using a preference table.
- Python: custom mapping dict + `Seq()` (BioPython)
## Required Imports
```python
from Bio.Seq import Seq
from Bio.SeqUtils import GC123
from Bio.SeqUtils.CodonUsage import CodonAdaptationIndex
from Bio.Data import CodonTable
from collections import Counter
```
## Basic Codon Counting
**Goal:** Tabulate codon frequencies in a coding sequence.
**Approach:** Split the sequence into triplets from the reading frame start, then count with `Counter`.
### Count Codons in Sequence
```python
from collections import Counter
def count_codons(seq):
seq_str = str(seq).upper()
codons = [seq_str[i:i+3] for i in range(0, len(seq_str) - 2, 3)]
return Counter(codons)
seq = Seq('ATGCGATCGATCGATCGTAA')
codon_counts = count_codons(seq)
```
### Codon Frequencies (Relative)
```python
def codon_frequencies(seq):
counts = count_codons(seq)
total = sum(counts.values())
return {codon: count / total for codon, count in counts.items()}
```
## Codon Adaptation Index (CAI)
**Goal:** Measure how well a gene's codon usage matches highly expressed genes in a target organism.
**Approach:** Train a CAI index from a reference set of highly expressed genes, then score query sequences (0-1 scale, higher = better adapted).
### Using CodonUsage Module
```python
from Bio.SeqUtils.CodonUsage import CodonAdaptationIndex
# Create CAI calculator with reference set
cai = CodonAdaptationIndex()
# Generate index from highly expressed genes
cai.generate_index('highly_expressed_genes.fasta')
# Calculate CAI for a sequence
seq = Seq('ATGCGATCGATCGATCGTAA')
cai_value = cai.cai_for_gene(str(seq))
print(f'CAI: {cai_value:.3f}') # Range 0-1, higher = better adapted
```
### CAI with Custom Codon Index
```python
from Bio.SeqUtils.CodonUsage import CodonAdaptationIndex
cai = CodonAdaptationIndex()
# Set custom index (relative adaptiveness for each codon)
custom_index = {
'TTT': 0.5, 'TTC': 1.0, # Phe
'TTA': 0.1, 'TTG': 0.5, 'CTT': 0.3, 'CTC': 1.0, 'CTA': 0.1, 'CTG': 1.0, # Leu
# ... define all 64 codons
}
cai.set_cai_index(custom_index)
```
## Synonymous Codon Usage
**Goal:** Quantify bias in synonymous codon usage to detect selection or mutational pressure.
**Approach:** Calculate RSCU — the ratio of observed to expected frequency assuming equal usage of synonymous codons. RSCU = 1.0 means no bias; >1 overused, <1 underused.
### RSCU (Relative Synonymous Codon Usage)
```python
from Bio.Data import CodonTable
def calculate_rscu(seq, table_id=1):
codon_table = CodonTable.unambiguous_dna_by_id[table_id]
counts = count_codons(seq)
# Group codons by amino acid
aa_to_codons = {}
for codon in counts:
if codon in codon_table.stop_codons:
continue
try:
aa = codon_table.forward_table[codon]
aa_to_codons.setdefault(aa, []).append(codon)
except KeyError:
continue
# Calculate RSCU for each codon
rscu = {}
for aa, codons in aa_to_codons.items():
total = sum(counts.get(c, 0) for c in codons)
n_synonymous = len(codons)
expected = total / n_synonymous if n_synonymous > 0 else 0
for codon in codons:
observed = counts.get(codon, 0)
rscu[codon] = observed / expected if expected > 0 else 0
return rscu
```
### Identify Rare Codons
```python
def find_rare_codons(seq, threshold=0.1):
freq = codon_frequencies(seq)
return {codon: f for codon, f in freq.items() if f < threshold}
```
### Codon Bias by Position (GC123)
```python
from Bio.SeqUtils import GC123
seq = Seq('ATGCGATCGATCGATCGATCGATCGATCGTAA')
gc_total, gc_pos1, gc_pos2, gc_pos3 = GC123(seq)
print(f'Total GC: {gc_total:.1f}%')
print(f'1st position GC: {gc_pos1:.1f}%')
print(f'2nd position GC: {gc_pos2:.1f}%')
print(f'3rd position GC: {gc_pos3:.1f}% (wobble position)')
```
## Codon Tables
### Access Codon Tables
```python
from Bio.Data import CodonTable
# Get standard table
std_table = CodonTable.unambiguous_dna_by_id[1]
# List all available tables
for id, table in CodonTable.unambiguous_dna_by_id.items():
print(f'{id}: {table.names[0]}')
```
### Common Codon Tables
| ID | Name | Organism |
|----|------|----------|
| 1 | Standard | Most organisms |
| 2 | Vertebrate Mitochondrial | Human, mouse mito |
| 4 | Mold Mitochondrial | Fungi, protozoa mito |
| 5 | Invertebrate Mitochondrial | Insects, worms mito |
| 11 | Bacterial/Plastid | E. coli, chloroplasts |
### Codon Table Properties
```python
table = CodonTable.unambiguous_dna_by_id[1]
print(f'Start codons: {table.start_codons}')
print(f'Stop codons: {table.stop_codons}')
# Forward table: codon -> amino acid
print(table.forward_table['ATG']) # 'M'
# Back table: amino acid -> list of codons
back_table = {}
for codon, aa in table.forward_table.items():
back_table.setdefault(aa, []).append(codon)
print(f'Leucine codons: {back_table["L"]}')
```
## Code Patterns
### Full Codon Usage Report
```python
def codon_usage_report(seq, table_id=1):
from Bio.Data import CodonTable
table = CodonTable.unambiguous_dna_by_id[table_id]
counts = count_codons(seq)
total = sum(counts.values())
# Group by amino acid
aa_groups = {}
for codon, aa in table.forward_table.items():
aa_groups.setdefault(aa, []).append(codon)
report = {}
for aa, codons in sorted(aa_groups.items()):
aa_total = sum(counts.get(c, 0) for c in codons)
report[aa] = {
'total': aa_total,
'codons': {c: {'count': counts.get(c, 0),
'freq': counts.get(c, 0) / aa_total if aa_total > 0 else 0}
for c in codons}
}
return report
```
### Compare Codon Usage Between Sequences
```python
def compare_codon_usage(seq1, seq2):
freq1 = codon_frequencies(seq1)
freq2 = codon_frequencies(seq2)
all_codons = set(freq1.keys()) | set(freq2.keys())
comparison = {}
for codon in sorted(all_codons):
f1, f2 = freq1.get(codon, 0), freq2.get(codon, 0)
comparison[codon] = {'seq1': f1, 'seq2': f2, 'diff': f1 - f2}
return comparison
```
### Optimize Codons for Expression
**Goal:** Replace codons with host-preferred synonymous alternatives to maximize protein expression.
**Approach:** Map each amino acid to its most-preferred codon in the target host, then reconstruct the DNA sequence.
```python
def optimize_codons(protein_seq, preferred_codons):
'''Replace codons with preferred synonymous codons'''
optimized = []
for aa in str(protein_seq):
if aa in preferred_codons:
optimized.append(preferred_codons[aa])
else:
optimized.append('NNN') # Unknown
return Seq(''.join(optimized))
# E. coli preferred codons
ecoli_preferred = {
'A': 'GCG', 'R': 'CGT', 'N': 'AAC', 'D': 'GAT', 'C': 'TGC',
'Q': 'CAG', 'E': 'GAA', 'G': 'GGT', 'H': 'CAC', 'I': 'ATT',
'L': 'CTG', 'K': 'AAA', 'M': 'ATG', 'F': 'TTC', 'P': 'CCG',
'S': 'TCT', 'T': 'ACC', 'W': 'TGG', 'Y': 'TAC', 'V': 'GTT',
}
```
### Codon Usage from FASTA File
```python
from Bio import SeqIO
def analyze_fasta_codon_usage(filename):
all_counts = Counter()
for record in SeqIO.parse(filename, 'fasta'):
all_counts.update(count_codons(record.seq))
total = sum(all_counts.values())
return {codon: count / total for codon, count in all_counts.items()}
```
### Effective Number of Codons (Nc)
A measure of codon bias (lower = more biased, range 20-61):
```python
import math
def effective_nc(seq, table_id=1):
from Bio.Data import CodonTable
table = CodonTable.unambiguous_dna_by_id[table_id]
counts = count_codons(seq)
# Group by degeneracy class
aa_groups = {}
for codon, aa in table.forward_table.items():
aa_groups.setdefault(aa, []).append(codon)
# Calculate F for each amino acid
nc_sum = 0
for aa, codons in aa_groups.items():
n = sum(counts.get(c, 0) for c in codons)
if n <= 1:
continue
pi_sq_sum = sum((counts.get(c, 0) / n) ** 2 for c in codons)
F = (n * pi_sq_sum - 1) / (n - 1)
nc_sum += 1 / F if F > 0 else len(codons)
return nc_sum if nc_sum > 0 else 61
```
## Property Reference
| Metric | Range | Interpretation |
|--------|-------|----------------|
| CAI | 0-1 | Higher = better adapted to host |
| RSCU | 0-N | 1.0 = no bias, >1 = overused, <1 = underused |
| Nc | 20-61 | Lower = more biased |
| GC3 | 0-100% | GC at wobble position |
## Common Errors
| Error | Cause | Solution |
|-------|-------|----------|
| `KeyError` | Non-standard codon | Handle N-containing codons |
| Wrong counts | Sequence not in frame | Ensure length is multiple of 3 |
| No index set | Called CAI without training | Call `generate_index()` first |
## Decision Tree
```
Need to analyze codon usage?
├── Count codon frequencies?
│ └── Use Counter on 3-mers
├── Calculate adaptation to host?
│ └── Use CodonAdaptationIndex (CAI)
├── Identify synonymous bias?
│ └── Calculate RSCU
├── Check wobble position bias?
│ └── Use GC123()
├── Measure overall bias?
│ └── Calculate Nc (effective number of codons)
└── Optimize for expression?
└── Replace with preferred synonymous codons
```
## Related Skills
- transcription-translation - Translate sequences and understand codon tables
- sequence-properties - GC123 for wobble position GC content
- sequence-io/read-sequences - Parse CDS sequences from GenBank files
- database-access/entrez-fetch - Fetch reference gene sets from NCBI for CAI training
This skill analyzes codon usage in coding DNA sequences, computes adaptation metrics like CAI, and inspects synonymous codon bias using Biopython utilities. It provides codon counts, relative frequencies, RSCU, GC123 wobble analysis, and tools to optimize coding sequences for host expression. Use it to evaluate expression potential or probe evolutionary selection on codon choice.
The skill parses coding sequences into triplet codons and tallies occurrences with Counter. It uses Biopython's CodonAdaptationIndex to train or apply host codon indices and calculates CAI scores. Synonymous bias is assessed by computing RSCU per codon and effective number of codons (Nc). GC content by codon position is computed with GC123.
Do I need a reference set to compute CAI?
Yes. CAI requires a codon index derived from highly expressed genes in the target host; generate it with generate_index() or supply a custom index.
What does RSCU tell me that simple codon frequency does not?
RSCU normalizes codon counts by the number of synonymous codons for each amino acid, revealing relative over- or underuse independent of amino acid composition.