home / skills / gptomics / bioskills / clip-pipeline

clip-pipeline skill

/workflows/clip-pipeline

This skill guides end-to-end CLIP-seq analysis from FASTQ to binding sites and motifs, integrating QC, alignment, deduplication, peak calling, and motif

npx playbooks add skill gptomics/bioskills --skill clip-pipeline

Review the files below or copy the command above to add this skill to your agents.

Files (3)
SKILL.md
7.2 KB
---
name: bio-workflows-clip-pipeline
description: End-to-end CLIP-seq analysis from FASTQ to binding sites and motif enrichment. Use when analyzing protein-RNA interactions from CLIP-based methods.
tool_type: mixed
primary_tool: CLIPper
---

## Version Compatibility

Reference examples tested with: FastQC 0.12+, STAR 2.7.11+, bedtools 2.31+, cutadapt 4.4+, samtools 1.19+

Before using code patterns, verify installed versions match. If versions differ:
- CLI: `<tool> --version` then `<tool> --help` to confirm flags

If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.

# CLIP-seq Pipeline

**"Analyze my CLIP-seq data from FASTQ to binding sites and motifs"** → Orchestrate UMI extraction, adapter trimming, STAR alignment, PCR deduplication, CLIPper/PureCLIP peak calling, binding site annotation, and HOMER motif enrichment.

## Pipeline Overview

```
FASTQ → QC → UMI extract → Trim adapters → Align → Filter → Dedup → Peak call → Annotate → Motifs
```

## CLIP Method Variants

| Method | UMI | Crosslink Site | Adapter |
|--------|-----|----------------|---------|
| HITS-CLIP | Optional | Deletions | 3' adapter |
| PAR-CLIP | Optional | T→C mutations | 3' adapter |
| iCLIP | Required | 5' of read | 3' adapter |
| eCLIP | Required | 5' of read | 3' adapter |

## Step 1: Quality Control

```bash
# Initial QC
fastqc reads.fastq.gz -o qc_pre/

# Check for adapter contamination and UMI structure
# For eCLIP: expect 10nt UMI at read start
zcat reads.fastq.gz | head -n 100 | cut -c1-15
```

## Step 2: UMI Extraction

```bash
# eCLIP (10nt UMI at 5' end)
umi_tools extract \
    --stdin=reads.fastq.gz \
    --bc-pattern=NNNNNNNNNN \
    --stdout=extracted.fastq.gz \
    --log=umi_extract.log

# iCLIP (5nt experimental barcode + 5nt UMI)
umi_tools extract \
    --stdin=reads.fastq.gz \
    --bc-pattern=NNNNNXXXXX \
    --stdout=extracted.fastq.gz
```

## Step 3: Adapter Trimming

```bash
# Trim 3' adapter (common eCLIP adapter)
cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \
    --minimum-length 20 \
    --quality-cutoff 20 \
    -o trimmed.fastq.gz \
    extracted.fastq.gz

# For paired UMI adapters
cutadapt -a AGATCGGAAGAGCACACGTCT \
    -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \
    --minimum-length 20 \
    -o trimmed_R1.fq.gz -p trimmed_R2.fq.gz \
    extracted_R1.fq.gz extracted_R2.fq.gz
```

## Step 4: Alignment

```bash
# Build STAR index (once)
STAR --runMode genomeGenerate \
    --genomeDir star_index \
    --genomeFastaFiles genome.fa \
    --sjdbGTFfile genes.gtf \
    --sjdbOverhang 100

# Align with STAR (optimized for short CLIP reads)
STAR --genomeDir star_index \
    --readFilesIn trimmed.fastq.gz \
    --readFilesCommand zcat \
    --outFilterMismatchNmax 2 \
    --outFilterMultimapNmax 1 \
    --outSAMtype BAM SortedByCoordinate \
    --outSAMattributes All \
    --alignEndsType EndToEnd \
    --outFileNamePrefix clip_
```

## Step 5: Alignment Filtering

```bash
# Remove unmapped and low-quality reads
samtools view -b -F 4 -q 10 clip_Aligned.sortedByCoord.out.bam > filtered.bam
samtools index filtered.bam

# Optional: remove reads mapping to rRNA/tRNA
bedtools intersect -v -abam filtered.bam -b rrna_trna.bed > filtered_norRNA.bam
```

## Step 6: PCR Deduplication

```bash
# UMI-aware deduplication
umi_tools dedup \
    -I filtered.bam \
    -S dedup.bam \
    --output-stats=dedup_stats

samtools index dedup.bam

# Check deduplication rate
echo "Duplication rate:" $(grep "Input Reads" dedup_stats.log | awk '{print $3}')
```

## Step 7: Peak Calling

```bash
# CLIPper (recommended)
clipper -b dedup.bam -s hg38 -o peaks.bed --FDR 0.05 --superlocal

# Alternative: Piranha
Piranha -s dedup.bam -o piranha_peaks.bed -p 0.01

# For PAR-CLIP with T→C mutations
PARalyzer settings.ini

# Strand-specific calling
samtools view -h -F 16 dedup.bam | samtools view -Sb - > plus.bam
samtools view -h -f 16 dedup.bam | samtools view -Sb - > minus.bam
clipper -b plus.bam -s hg38 -o peaks_plus.bed
clipper -b minus.bam -s hg38 -o peaks_minus.bed
cat peaks_plus.bed peaks_minus.bed | sort -k1,1 -k2,2n > peaks_stranded.bed
```

## Step 8: Peak Annotation

```bash
# Annotate with gene features
bedtools intersect -a peaks.bed -b genes.gtf -wo > peaks_annotated.txt

# Or use HOMER
annotatePeaks.pl peaks.bed hg38 > peaks_homer_annotated.txt

# Feature distribution
awk -F'\t' '{print $8}' peaks_homer_annotated.txt | sort | uniq -c | sort -rn
```

## Step 9: Motif Analysis

```bash
# Extract peak sequences
bedtools getfasta -fi genome.fa -bed peaks.bed -s -fo peaks.fa

# HOMER motif finding (RNA mode)
findMotifs.pl peaks.fa fasta motif_output -rna -len 5,6,7,8 -p 8

# MEME-ChIP
meme-chip -oc meme_output -dna peaks.fa -meme-mod zoops -meme-nmotifs 10
```

## Step 10: Cross-link Site Analysis

```bash
# For iCLIP/eCLIP: identify crosslink sites (read 5' ends)
bedtools genomecov -ibam dedup.bam -bg -5 -strand + > crosslinks_plus.bg
bedtools genomecov -ibam dedup.bam -bg -5 -strand - > crosslinks_minus.bg

# For PAR-CLIP: identify T→C conversion sites
# Requires specialized tools like PARpipe
```

## Quality Checkpoints

| Step | Metric | Expected |
|------|--------|----------|
| Raw | Read count | >10M |
| Trimmed | Reads >20bp | >80% |
| Aligned | Mapping rate | >50% |
| Dedup | Unique rate | >20% |
| Peaks | Peak count | 1,000-50,000 |
| Peaks | Median width | 20-100 nt |
| FRiP | Reads in peaks | >10% |

```bash
# Calculate FRiP
reads_in_peaks=$(bedtools intersect -a dedup.bam -b peaks.bed -u | samtools view -c -)
total_reads=$(samtools view -c dedup.bam)
frip=$(echo "scale=4; $reads_in_peaks / $total_reads" | bc)
echo "FRiP: $frip"
```

## Complete Pipeline Script

```bash
#!/bin/bash
set -euo pipefail

SAMPLE=$1
READS=$2
GENOME_DIR=$3
GENOME_FA=$4

mkdir -p qc trimmed aligned peaks motifs

# QC
fastqc $READS -o qc/

# UMI extract
umi_tools extract --stdin=$READS --bc-pattern=NNNNNNNNNN \
    --stdout=trimmed/${SAMPLE}_extracted.fq.gz

# Trim
cutadapt -a AGATCGGAAGAGCACACGTCT --minimum-length 20 \
    -o trimmed/${SAMPLE}_trimmed.fq.gz trimmed/${SAMPLE}_extracted.fq.gz

# Align
STAR --genomeDir $GENOME_DIR --readFilesIn trimmed/${SAMPLE}_trimmed.fq.gz \
    --readFilesCommand zcat --outFilterMismatchNmax 2 --outFilterMultimapNmax 1 \
    --outSAMtype BAM SortedByCoordinate --outFileNamePrefix aligned/${SAMPLE}_

# Filter and dedup
samtools view -b -F 4 -q 10 aligned/${SAMPLE}_Aligned.sortedByCoord.out.bam | \
    samtools sort -o aligned/${SAMPLE}_filtered.bam
samtools index aligned/${SAMPLE}_filtered.bam
umi_tools dedup -I aligned/${SAMPLE}_filtered.bam -S aligned/${SAMPLE}_dedup.bam
samtools index aligned/${SAMPLE}_dedup.bam

# Peaks
clipper -b aligned/${SAMPLE}_dedup.bam -s hg38 -o peaks/${SAMPLE}_peaks.bed

# Motifs
bedtools getfasta -fi $GENOME_FA -bed peaks/${SAMPLE}_peaks.bed -s -fo peaks/${SAMPLE}.fa
findMotifs.pl peaks/${SAMPLE}.fa fasta motifs/${SAMPLE} -rna -len 5,6,7 -p 4

echo "Pipeline complete for $SAMPLE"
```

## Related Skills

- clip-seq/clip-preprocessing - Detailed preprocessing
- clip-seq/clip-alignment - Alignment optimization
- clip-seq/clip-peak-calling - Peak caller comparison
- clip-seq/binding-site-annotation - Feature annotation
- clip-seq/clip-motif-analysis - Motif discovery

Overview

This skill provides an end-to-end CLIP-seq analysis pipeline from raw FASTQ to binding sites and motif enrichment. It orchestrates UMI extraction, adapter trimming, STAR alignment, PCR deduplication, peak calling, annotation, and motif discovery. The workflow supports common CLIP variants (eCLIP, iCLIP, PAR-CLIP, HITS-CLIP) and includes checkpoints for quality metrics.

How this skill works

The pipeline first performs QC and inspects UMI/adapters, then extracts UMIs and trims adapters. Reads are aligned with STAR using short-read settings, filtered for quality and rRNA/tRNA, and deduplicated with umi_tools. Peaks are called with CLIPper (or alternatives), annotated against gene models, and sequences are passed to HOMER or MEME for motif enrichment. Crosslink sites and conversion signatures (e.g., T→C for PAR-CLIP) are handled with strand-aware coverage and specialized tools.

When to use it

  • Analyzing protein–RNA interactions from CLIP-based experiments (eCLIP, iCLIP, PAR-CLIP, HITS-CLIP).
  • You have FASTQ files and need a reproducible pipeline to call binding sites and motifs.
  • When UMI-aware deduplication is required to correct PCR duplication.
  • To produce annotated peak sets and motif enrichment reports for downstream analysis.
  • When you need strand-specific crosslink site mapping or conversion-site detection.

Best practices

  • Verify tool versions (FastQC, STAR, cutadapt, samtools, bedtools, umi_tools) and adapt flags if APIs differ.
  • Inspect early QC to confirm UMI locations and adapter sequences before extraction and trimming.
  • Use UMI-aware deduplication for iCLIP/eCLIP and keep alignment settings strict (low mismatches, unique mapping).
  • Run strand-specific peak calling and compute FRiP and duplication metrics at checkpoints.
  • Validate peak annotation with both bedtools and HOMER and use motif tools in RNA mode when available.

Example use cases

  • Process eCLIP samples with 10-nt 5' UMIs to obtain high-confidence binding sites and enriched motifs.
  • Analyze PAR-CLIP data to identify T→C conversion hotspots and associated binding peaks.
  • Run a batch pipeline for multiple samples: QC → UMI extraction → trim → STAR align → dedup → CLIPper → HOMER.
  • Compare peak callers (CLIPper vs Piranha) and inspect feature distributions across 5' UTR, CDS, and 3' UTR.
  • Generate crosslink site bedGraph tracks for visualization and compute FRiP for quality assessment.

FAQ

What CLIP variants require UMIs and strand-specific handling?

iCLIP and eCLIP typically require UMIs and use the 5' read end for crosslink site mapping. HITS-CLIP and PAR-CLIP may have optional UMIs; PAR-CLIP also needs mutation-aware analysis (T→C).

Which peak caller should I use?

CLIPper is recommended for general CLIP data; Piranha is an alternative. For PAR-CLIP consider PARalyzer for mutation-aware calling. Compare callers on your data and inspect peaks manually.