home / skills / gptomics / bioskills / adapter-trimming
This skill helps remove sequencing adapters from FASTQ files using Cutadapt and Trimmomatic to improve alignment readiness.
npx playbooks add skill gptomics/bioskills --skill adapter-trimmingReview the files below or copy the command above to add this skill to your agents.
---
name: bio-read-qc-adapter-trimming
description: Remove sequencing adapters from FASTQ files using Cutadapt and Trimmomatic. Supports single-end and paired-end reads, Illumina TruSeq, Nextera, and custom adapter sequences. Use when FastQC shows adapter contamination or before alignment of short reads.
tool_type: cli
primary_tool: cutadapt
---
## Version Compatibility
Reference examples tested with: FastQC 0.12+, Trimmomatic 0.39+, cutadapt 4.4+, fastp 0.23+
Before using code patterns, verify installed versions match. If versions differ:
- CLI: `<tool> --version` then `<tool> --help` to confirm flags
If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.
# Adapter Trimming
Remove sequencing adapters from reads using Cutadapt (precise, flexible) or Trimmomatic (paired-end optimized).
**"Trim adapters from reads"** → Remove sequencing adapter sequences from FASTQ reads to prevent adapter contamination in downstream alignment.
- CLI: `cutadapt -a ADAPTER -o out.fq in.fq` or `trimmomatic PE` with ILLUMINACLIP
- CLI: `fastp -i in.fq -o out.fq` (auto-detects adapters)
## Common Adapter Sequences
| Platform/Kit | Adapter | Sequence |
|--------------|---------|----------|
| Illumina TruSeq | Read 1 3' | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA |
| Illumina TruSeq | Read 2 3' | AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT |
| Nextera | Transposase | CTGTCTCTTATACACATCT |
| Small RNA | 3' adapter | TGGAATTCTCGGGTGCCAAGG |
| Poly-A | Poly-A tail | AAAAAAAAAAAAAAAA |
## Cutadapt
### Single-End Reads
```bash
# 3' adapter (most common)
cutadapt -a AGATCGGAAGAGC -o trimmed.fastq.gz sample.fastq.gz
# 5' adapter
cutadapt -g ACGTACGT -o trimmed.fastq.gz sample.fastq.gz
# Both ends
cutadapt -a ADAPTER1 -g ADAPTER2 -o trimmed.fastq.gz sample.fastq.gz
# Multiple adapters (tries each)
cutadapt -a ADAPTER1 -a ADAPTER2 -a ADAPTER3 -o trimmed.fastq.gz sample.fastq.gz
```
### Paired-End Reads
```bash
# Basic paired-end
cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \
-A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \
-o trimmed_R1.fastq.gz -p trimmed_R2.fastq.gz \
sample_R1.fastq.gz sample_R2.fastq.gz
# Short form for Illumina TruSeq (auto-detect)
cutadapt -a AGATCGGAAGAGC -A AGATCGGAAGAGC \
-o trimmed_R1.fastq.gz -p trimmed_R2.fastq.gz \
sample_R1.fastq.gz sample_R2.fastq.gz
```
### Adapter Options
```bash
# Error rate (default 0.1 = 10% mismatches allowed)
cutadapt -a ADAPTER -e 0.15 -o out.fq in.fq
# Minimum overlap (default 3)
cutadapt -a ADAPTER -O 5 -o out.fq in.fq
# No indels in adapter alignment
cutadapt -a ADAPTER --no-indels -o out.fq in.fq
# Trim Ns from ends
cutadapt --trim-n -o out.fq in.fq
# Anchored adapters (must be at end)
cutadapt -a ADAPTER$ -o out.fq in.fq
```
### Linked Adapters
```bash
# 5' adapter followed by 3' adapter (same read)
cutadapt -a ADAPTER1...ADAPTER2 -o out.fq in.fq
# Anchored 5' linked to 3'
cutadapt -a ^ADAPTER1...ADAPTER2 -o out.fq in.fq
```
### Filtering After Trimming
```bash
# Minimum length (discard shorter)
cutadapt -a ADAPTER -m 20 -o out.fq in.fq
# Maximum length
cutadapt -a ADAPTER -M 150 -o out.fq in.fq
# Maximum N content
cutadapt -a ADAPTER --max-n 0.1 -o out.fq in.fq
# Discard trimmed reads
cutadapt -a ADAPTER --discard-trimmed -o out.fq in.fq
# Discard untrimmed reads
cutadapt -a ADAPTER --discard-untrimmed -o out.fq in.fq
```
### Paired-End Filtering
```bash
# Both reads must pass minimum length
cutadapt -a ADAPT1 -A ADAPT2 -m 20 \
-o R1.fq -p R2.fq in_R1.fq in_R2.fq
# Output too-short reads separately
cutadapt -a ADAPT1 -A ADAPT2 -m 20 \
--too-short-output short_R1.fq --too-short-paired-output short_R2.fq \
-o R1.fq -p R2.fq in_R1.fq in_R2.fq
```
### Action Options
```bash
# Mask adapter instead of trim (replace with N)
cutadapt -a ADAPTER --action=mask -o out.fq in.fq
# Retain adapter but lowercase
cutadapt -a ADAPTER --action=lowercase -o out.fq in.fq
# Just find adapters, don't modify
cutadapt -a ADAPTER --action=none -o out.fq in.fq
```
## Trimmomatic
### Single-End Mode
```bash
trimmomatic SE -phred33 \
input.fastq.gz output.fastq.gz \
ILLUMINACLIP:adapters.fa:2:30:10
```
### Paired-End Mode
```bash
trimmomatic PE -phred33 -threads 4 \
input_R1.fastq.gz input_R2.fastq.gz \
output_R1_paired.fastq.gz output_R1_unpaired.fastq.gz \
output_R2_paired.fastq.gz output_R2_unpaired.fastq.gz \
ILLUMINACLIP:TruSeq3-PE-2.fa:2:30:10
```
### ILLUMINACLIP Parameters
```bash
ILLUMINACLIP:<fastaWithAdapters>:<seed>:<palindrome>:<simple>
# Parameters:
# seed - max mismatches in 16bp seed (usually 2)
# palindrome - threshold for palindrome match (usually 30)
# simple - threshold for simple match (usually 10)
# Example with all options
ILLUMINACLIP:adapters.fa:2:30:10:2:keepBothReads
```
### Built-in Adapter Files
Trimmomatic includes adapter files:
- `TruSeq2-SE.fa` - TruSeq v2 single-end
- `TruSeq2-PE.fa` - TruSeq v2 paired-end
- `TruSeq3-SE.fa` - TruSeq v3 single-end
- `TruSeq3-PE.fa` - TruSeq v3 paired-end
- `TruSeq3-PE-2.fa` - TruSeq v3 PE (palindrome mode)
- `NexteraPE-PE.fa` - Nextera paired-end
### Find Trimmomatic Adapters
```bash
# Find adapter directory
TRIMMOMATIC_JAR=$(which trimmomatic | xargs dirname)/../share/trimmomatic-*/adapters/
# Or with conda
ls $CONDA_PREFIX/share/trimmomatic-*/adapters/
```
## Performance
```bash
# Cutadapt with multiple cores
cutadapt -j 8 -a ADAPTER -o out.fq in.fq
# Trimmomatic threads
trimmomatic PE -threads 8 ...
```
## Verify Trimming
```bash
# Check adapter removal with FastQC
fastqc trimmed.fastq.gz
# Count reads before/after
zcat input.fastq.gz | wc -l
zcat trimmed.fastq.gz | wc -l
```
## Related Skills
- quality-reports - Check adapter content with FastQC
- quality-filtering - Quality trimming after adapter removal
- fastp-workflow - Combined adapter and quality trimming
This skill removes sequencing adapters from FASTQ files using Cutadapt and Trimmomatic, supporting single-end and paired-end workflows. It includes presets for Illumina TruSeq and Nextera adapters and accepts custom sequences. Use it to eliminate adapter contamination before alignment or variant calling. The skill is practical for pipelines that require robust, reproducible trimming steps.
The skill runs Cutadapt for precise, flexible adapter detection and trimming, with options for anchored adapters, error rate, overlap, linked adapters, and post-trim filtering. For paired-end data or when using built-in adapter libraries, Trimmomatic is available with ILLUMINACLIP settings and multi-threading. It also surfaces common adapter sequences and commands to verify trimming results with FastQC and read counts.
How do I decide between Cutadapt and Trimmomatic?
Use Cutadapt for flexible adapter patterns, linked or anchored adapters, or complex filtering. Use Trimmomatic for paired-end workflows that benefit from built-in adapter files and palindrome detection.
What parameters prevent overtrimming useful sequence?
Keep error rate moderate (default 0.1), increase minimum overlap (-O) to 5 if adapters are short, and set a sensible minimum length (-m 20) to retain informative reads.
How can I verify trimming worked correctly?
Run FastQC on trimmed FASTQ and compare adapter content and per-base sequence quality. Also compare read counts before and after trimming (e.g., zcat | wc -l) to detect unexpected losses.